Popcorn Pandora Litecoin Game Dog - Mix of Corgi, Dachshund, Shiba Inu, Yorkshire Terrier, Schnauzer, Border Collie, Grey Wolf and Pitbull terrier

Achievements

Podium Champion
Pro Racer
Master Champion
Popcorn Pandora
What's up, pup? Name's Popcorn Pandora. I was born in the web cloud. I like it when you're frisky. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. Sometimes I just have to roll in something dead. You scratch my belly and I'll scratch yours ;)
  • Purity 6%
  • Age 38 months
  • Racing Exp 154
  • Corgi 27%
  • 35 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

35 races   |
  • 7 5 8
 Best Time14.02 sec
No rank  Racing *** Pts
57.1 % wins (20) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATTAATATACAGCCCCAGCTCCGGAAGCGGA
G
T
A
T
T
A
A
T
A
T
A
C
A
G
C
C
C
C
A
G
C
T
C
C
G
G
A
A
G
C
G
G
A
Genes: EFCJOLONAOA

Composition

Corgi
27%
Dachshund
18%
Shiba Inu
9%
Yorkshire Terrier
9%
Schnauzer
9%
Border Collie
9%
Grey Wolf
9%
Pitbull terrier
9%

Current Energy

Vitality -49 points
Lunar Effect -10 points

Traits Breakdown

Body Shiba Inu
Tail Yorkshire Terrier
Legs Schnauzer
Front Legs Border Collie
Head Corgi
Ears Grey Wolf
Snout Corgi
Mouth Pitbull terrier
Nose Dachshund
Eyes Corgi
Color Dachshund