Popcorn Pandora

What's up, pup? Name's Popcorn Pandora. I was born in the web cloud. I like it when you're frisky. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. Sometimes I just have to roll in something dead. You scratch my belly and I'll scratch yours ;)

Purity 6%
Age 38 months
Racing Exp 154

Corgi 27%
35 races
Gen 0

Depressed & Snaillike

Energy: ▂▃▅▆▇

Racing Stats


35 races \| 7 5 8	Best Time	14.02 sec
No rank	Racing	*** Pts
57.1 % wins (20)	Breeding	*** Pts
Scheduled races 0	Total	*** Pts

DNA Analysis

DNA Sequence: GTATTAATATACAGCCCCAGCTCCGGAAGCGGA

Genes: EFCJOLONAOA

Composition

Corgi	27%
Dachshund	18%
Shiba Inu	9%
Yorkshire Terrier	9%
Schnauzer	9%
Border Collie	9%
Grey Wolf	9%
Pitbull terrier	9%

Current Energy

Vitality	-49 points
Lunar Effect	-10 points

Traits Breakdown

Body	Shiba Inu
Tail	Yorkshire Terrier
Legs	Schnauzer
Front Legs	Border Collie
Head	Corgi
Ears	Grey Wolf
Snout	Corgi
Mouth	Pitbull terrier
Nose	Dachshund
Eyes	Corgi
Color	Dachshund