Pepper Pickles Crypto Game Dog - Mix of Corgi, St. Bernard, German Shepard, Border Collie, Shiba Inu, Pug, Yorkshire Terrier, Golder Retriever and Dachshund

Achievements

Racer
Pepper Pickles
Nyan Cat is my best friend here in the cyberspace. I've been looking for love in all the wrong places... I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I'm into recreational spankings and a little 'ruff' play.
  • Purity 4%
  • Age 38 months
  • Racing Exp 15
  • Corgi 27%
  • 4 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 0 1 1
 Best Time14.90 sec
No rank  Racing *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGAAGCTCATACGTAGAAAGCTTAAGCAGAGGA
T
G
A
A
G
C
T
C
A
T
A
C
G
T
A
G
A
A
A
G
C
T
T
A
A
G
C
A
G
A
G
G
A
Genes: BO7JE2OFO8A

Composition

Corgi
27%
St. Bernard
9%
German Shepard
9%
Border Collie
9%
Shiba Inu
9%
Pug
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail Corgi
Legs German Shepard
Front Legs Border Collie
Head Shiba Inu
Ears Pug
Snout Corgi
Mouth Yorkshire Terrier
Nose Corgi
Eyes Golder Retriever
Color Dachshund

Parents

No Children

Photos

online pet race Litecoin doggy racing