Peaches Pupperino Bitcoin Dog - Mix of Corgi, Pug, St. Bernard, German Shepard, Shiba Inu, Schnauzer, Yorkshire Terrier, Golder Retriever and Grey Wolf

Achievements

Racer
Peaches Pupperino
Hey dawg! I'm Peaches Pupperino. I hate being left alone all day. People food disagrees with me. Whew! You can tell. I'm into recreational spankings and a little 'ruff' play. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! Getting out of a long relationship, not looking for another
  • Purity 3%
  • Age 39 months
  • Racing Exp 13
  • Corgi 18%
  • 8 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
8 races    Best Time15.02 sec
No rank  Racing *** Coins
12.5 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAAGCTCAGAAGTAGAAATATTAAGCAGACCC
T
G
A
A
G
C
T
C
A
G
A
A
G
T
A
G
A
A
A
T
A
T
T
A
A
G
C
A
G
A
C
C
C
Genes: BO72E2CFO8L

Composition

Corgi
18%
Pug
18%
St. Bernard
9%
German Shepard
9%
Shiba Inu
9%
Schnauzer
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Grey Wolf
9%

Current Energy

Vitality -50 points
Lunar Effect +4 points

Traits Breakdown

Body St. Bernard
Tail Corgi
Legs German Shepard
Front Legs Pug
Head Shiba Inu
Ears Pug
Snout Schnauzer
Mouth Yorkshire Terrier
Nose Corgi
Eyes Golder Retriever
Color Grey Wolf