Lucifer Louis Litecoin Dog - Mix of Shiba Inu, Yorkshire Terrier, Corgi, German Shepard, Dachshund, Golder Retriever and Grey Wolf

Achievements

Racer
Lucifer Louis
What's up? I'm Lucifer Louis. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? I'm willing to try little bondage, so my human chained me up! The absolute best time of day is dinner time! I like nibbling on most everything, but I'll bite if you want me to.
  • Purity 9%
  • Age 41 months
  • Racing Exp 1
  • Shiba Inu 18%
  • 1 races
  • Gen 1
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time17.30 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTATTAGGAAGAAGCCCCTTATCATCAAGCGTA
G
T
A
T
T
A
G
G
A
A
G
A
A
G
C
C
C
C
T
T
A
T
C
A
T
C
A
A
G
C
G
T
A
Genes: EFA8OLF77OE

Composition

Shiba Inu
18%
Yorkshire Terrier
18%
Corgi
18%
German Shepard
18%
Dachshund
9%
Golder Retriever
9%
Grey Wolf
9%

Current Energy

Vitality -48 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Yorkshire Terrier
Legs Dachshund
Front Legs Golder Retriever
Head Corgi
Ears Grey Wolf
Snout Yorkshire Terrier
Mouth German Shepard
Nose German Shepard
Eyes Corgi
Color Shiba Inu