Sugar Sven Crypto Game Dog - Mix of German Shepard, French Bulldog, Labrador BK, Dachshund, Golder Retriever, Yorkshire Terrier, Grey Wolf and Shiba Inu

Achievements

Podium Champion
Pro Racer
Sugar Sven
The smell of fresh manure to roll in makes me wild. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 8%
  • Age 40 months
  • Racing Exp 45
  • German Shepard 27%
  • 13 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 3 1 1
13 races    Best Time14.45 sec
Rank 82  Racing *** Coins
38.5 % wins (5) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAGCAGGAAGATCACGATTATCATCACCCGTA
C
G
A
G
C
A
G
G
A
A
G
A
T
C
A
C
G
A
T
T
A
T
C
A
T
C
A
C
C
C
G
T
A
Genes: 96A879F77LE

Composition

German Shepard
27%
French Bulldog
18%
Labrador BK
9%
Dachshund
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Grey Wolf
9%
Shiba Inu
9%

Current Energy

Vitality -41 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Labrador BK
Legs Dachshund
Front Legs Golder Retriever
Head German Shepard
Ears French Bulldog
Snout Yorkshire Terrier
Mouth German Shepard
Nose German Shepard
Eyes Grey Wolf
Color Shiba Inu