Weaver Woofer Bitcoin Dog - Mix of German Shepard, Schnauzer, Yorkshire Terrier, Maltese, Dachshund, Pitbull terrier and French Bulldog

Achievements

Racer
Podium Champion
Weaver Woofer
Hi! I'm Weaver Woofer! I make the best virtual pet. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I love it when you show a little teeth. I don't like going to the groomer. Leave my beautiful fur alone! Being able to lick myself is nice, but I want to find my special someone.
  • Purity 11%
  • Age 40 months
  • Racing Exp 83
  • German Shepard 27%
  • 34 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 3 3 2
34 races    Best Time15.05 sec
No rank  Racing *** Coins
23.5 % wins (8) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCATAGGATCCTCATTATTATCATCACGAATA
A
C
C
A
T
A
G
G
A
T
C
C
T
C
A
T
T
A
T
T
A
T
C
A
T
C
A
C
G
A
A
T
A
Genes: KCAN7FF779C

Composition

German Shepard
27%
Schnauzer
18%
Yorkshire Terrier
18%
Maltese
9%
Dachshund
9%
Pitbull terrier
9%
French Bulldog
9%

Current Energy

Vitality -45 points
Lunar Effect +2 points

Traits Breakdown

Body Maltese
Tail Schnauzer
Legs Dachshund
Front Legs Pitbull terrier
Head German Shepard
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth German Shepard
Nose German Shepard
Eyes French Bulldog
Color Schnauzer