Slobber-Knocker Stryker Cryptocurrency Game Dog - Mix of German Shepard, Grey Wolf, Rottweiler, Dachshund, French Bulldog and Schnauzer

Achievements

Speed Champion
Podium Champion
Pro Racer
Master Champion
Slobber-Knocker Stryker
Hey there... I'm Slobber-Knocker Stryker. I need laid otherwise I'm going to start agreeing with Grumpy Cat. As a perfectionist, I have to find just the right 'spot'. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 15%
  • Age 38 months
  • Racing Exp 254
  • German Shepard 36%
  • 74 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

74 races   |
  • 11 13 5
 Best Time13.55 sec
No rank  Racing *** Pts
39.2 % wins (29) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCTCAGGACCCTCACACCACTCATCACGAATA
C
C
C
T
C
A
G
G
A
C
C
C
T
C
A
C
A
C
C
A
C
T
C
A
T
C
A
C
G
A
A
T
A
Genes: L7AL7HH779C

Composition

German Shepard
36%
Grey Wolf
18%
Rottweiler
18%
Dachshund
9%
French Bulldog
9%
Schnauzer
9%

Current Energy

Vitality -3 points
Lunar Effect -18 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Dachshund
Front Legs Grey Wolf
Head German Shepard
Ears Rottweiler
Snout Rottweiler
Mouth German Shepard
Nose German Shepard
Eyes French Bulldog
Color Schnauzer