Dylan Doc McDoggins Crypto Game Dog - Mix of German Shepard, French Bulldog, Grey Wolf, Dachshund, Yorkshire Terrier, Rottweiler and Schnauzer

Achievements

Racer
Dylan Doc McDoggins
I run on the information superhighway and haven't been hit by a car yet. Blue toilet water turns me off. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day! I'm just looking for some puppy love.
  • Purity 11%
  • Age 42 months
  • Racing Exp 1
  • German Shepard 27%
  • 1 races
  • Gen 11
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.63 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTCAGGACGATCATTACACTCACGACGAATA
C
C
C
T
C
A
G
G
A
C
G
A
T
C
A
T
T
A
C
A
C
T
C
A
C
G
A
C
G
A
A
T
A
Genes: L7A97FH799C

Composition

German Shepard
27%
French Bulldog
27%
Grey Wolf
9%
Dachshund
9%
Yorkshire Terrier
9%
Rottweiler
9%
Schnauzer
9%

Current Energy

Vitality -23 points
Lunar Effect -12 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Dachshund
Front Legs French Bulldog
Head German Shepard
Ears Yorkshire Terrier
Snout Rottweiler
Mouth German Shepard
Nose French Bulldog
Eyes French Bulldog
Color Schnauzer