Daffy Doc McDoggins Litecoin Game Dog - Mix of French Bulldog, Yorkshire Terrier, Rottweiler and Boxer

Achievements

Racer
Daffy Doc McDoggins
Good day to you! I'm Daffy Doc McDoggins! I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! Oh, go ahead. Pet me. I know you want to. If you are looking for a pooch who's in touch with feelings, here I am.
  • Purity 53%
  • Age 41 months
  • Racing Exp 2
  • French Bulldog 73%
  • 2 races
  • Gen 10
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
2 races    Best Time15.58 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGACGACGACGACGATTACACAACCGACGACGA
C
G
A
C
G
A
C
G
A
C
G
A
C
G
A
T
T
A
C
A
C
A
A
C
C
G
A
C
G
A
C
G
A
Genes: 99999FHG999

Composition

French Bulldog
73%
Yorkshire Terrier
9%
Rottweiler
9%
Boxer
9%

Current Energy

Vitality -41 points
Lunar Effect +4 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Yorkshire Terrier
Snout Rottweiler
Mouth Boxer
Nose French Bulldog
Eyes French Bulldog
Color French Bulldog