Wallace Wallace Litecoin Dog - Mix of French Bulldog, Golder Retriever, German Shepard, Shiba Inu, Border Collie, Maltese and Boxer

Achievements

Racer
Wallace Wallace
When my human brushes my coat, I get frisky! Power outages and computer viruses scare me! My favorite pastime is playing tug-of-war with my human's underwear. I love connecting with my friends via pee-mail.
  • Purity 18%
  • Age 19 months
  • Racing Exp 22
  • French Bulldog 45%
  • 9 races
  • Gen 11
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 1 1 0
 Best Time15.50 sec
No rank  Racing *** Pts
22.2 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGATCAGTACGATACACCCGAAACCGACGACGA
A
G
A
T
C
A
G
T
A
C
G
A
T
A
C
A
C
C
C
G
A
A
A
C
C
G
A
C
G
A
C
G
A
Genes: 87E9JK9G999

Composition

French Bulldog
45%
Golder Retriever
9%
German Shepard
9%
Shiba Inu
9%
Border Collie
9%
Maltese
9%
Boxer
9%

Current Energy

Vitality -27 points
Lunar Effect -12 points

Traits Breakdown

Body Golder Retriever
Tail German Shepard
Legs Shiba Inu
Front Legs French Bulldog
Head Border Collie
Ears Maltese
Snout French Bulldog
Mouth Boxer
Nose French Bulldog
Eyes French Bulldog
Color French Bulldog