Pokey Paddington Virtual Crypto Game Dog - Mix of French Bulldog, Golder Retriever, German Shepard, Shiba Inu, Border Collie, Maltese, Corgi, Labrador, Yorkshire Terrier and Dachshund
Pokey Paddington
  • Purity 1%
  • Age 14 months
  • Racing Exp 3
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I'm Pokey Paddington. How goes it? I live behind a firewall in the Machine. My favorite sport is catching treats my human throws! Once I caught a seagull, but it scared me so I let it go. I don't understand why my human tries to give me tap water. I expect filtered and distilled!

Racing Stats

Ran 3 races
  • 0 0 0
 Best Time16.85 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGATCAGTACGATACACCCGAAGCCCATTAGGA
A
G
A
T
C
A
G
T
A
C
G
A
T
A
C
A
C
C
C
G
A
A
G
C
C
C
A
T
T
A
G
G
A
Genes: 87E9JK9O5FA

Composition

French Bulldog
18%
Golder Retriever
9%
German Shepard
9%
Shiba Inu
9%
Border Collie
9%
Maltese
9%
Corgi
9%
Labrador
9%
Yorkshire Terrier
9%
Dachshund
9%

Current Energy

Vitality -27 points
Lunar Effect -10 points

Traits Breakdown

Body Golder Retriever
Tail German Shepard
Legs Shiba Inu
Front Legs French Bulldog
Head Border Collie
Ears Maltese
Snout French Bulldog
Mouth Corgi
Nose Labrador
Eyes Yorkshire Terrier
Color Dachshund