Porter Puffy Crypto Dog - Mix of French Bulldog, Golder Retriever and Boxer

Achievements

Racer
Porter Puffy
As a digital dog, let me say Bob Dole did not invent the internet. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.
  • Purity 51%
  • Age 19 months
  • Racing Exp 30
  • French Bulldog 73%
  • 7 races
  • Gen 12
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 0 3 1
 Best Time15.45 sec
No rank  Racing *** Pts
57.1 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGACGACGACGACGAAGACGAAACCGACGACGA
A
G
A
C
G
A
C
G
A
C
G
A
C
G
A
A
G
A
C
G
A
A
A
C
C
G
A
C
G
A
C
G
A
Genes: 8999989G999

Composition

French Bulldog
73%
Golder Retriever
18%
Boxer
9%

Current Energy

Vitality -33 points
Lunar Effect -20 points

Traits Breakdown

Body Golder Retriever
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Golder Retriever
Snout French Bulldog
Mouth Boxer
Nose French Bulldog
Eyes French Bulldog
Color French Bulldog

Parents

No Children

Photos

crypto pet racing photo virtual dog race virtual canine race photo Litecoin pet race podium