Porter Puffy Crypto Dog - Mix of French Bulldog, Golder Retriever and Boxer
Porter Puffy
  • Purity 51%
  • Age 16 months
  • Racing Exp 15
  • French Bulldog 73%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 3 races
  • Gen 12
Depressed & Snaillike

Achievements

Racer

Bio

As a digital dog, let me say Bob Dole did not invent the internet. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.

Racing Stats

Ran 3 races
  • 0 2 0
 Best Time15.45 sec
Rank 46  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGACGACGACGACGAAGACGAAACCGACGACGA
A
G
A
C
G
A
C
G
A
C
G
A
C
G
A
A
G
A
C
G
A
A
A
C
C
G
A
C
G
A
C
G
A
Genes: 8999989G999

Composition

French Bulldog
73%
Golder Retriever
18%
Boxer
9%

Current Energy

Vitality -33 points
Lunar Effect -20 points

Traits Breakdown

Body Golder Retriever
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Golder Retriever
Snout French Bulldog
Mouth Boxer
Nose French Bulldog
Eyes French Bulldog
Color French Bulldog

Parents

No Children

Photos

crypto canine race Bitcoin doggy race
Gift