Minnie Miss Havisham Litecoin Dog - Mix of French Bulldog, Shiba Inu, Beagle, St. Bernard, Golder Retriever, Yorkshire Terrier, Rottweiler, Pug, Border Collie and Schnauzer

Achievements

Racer
Minnie Miss Havisham
I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. My favorite position is doggie style ;) I'm sick of having my nails clipped, those are to help me dig! I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 1%
  • Age 38 months
  • Racing Exp 1
  • French Bulldog 18%
  • 1 races
  • Gen 11
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.40 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTACTACGATGAAGATTACACGAATACCGAATA
G
T
A
C
T
A
C
G
A
T
G
A
A
G
A
T
T
A
C
A
C
G
A
A
T
A
C
C
G
A
A
T
A
Genes: ED9B8FH2J9C

Composition

French Bulldog
18%
Shiba Inu
9%
Beagle
9%
St. Bernard
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Rottweiler
9%
Pug
9%
Border Collie
9%
Schnauzer
9%

Current Energy

Vitality -56 points
Lunar Effect -10 points

Traits Breakdown

Body Shiba Inu
Tail Beagle
Legs French Bulldog
Front Legs St. Bernard
Head Golder Retriever
Ears Yorkshire Terrier
Snout Rottweiler
Mouth Pug
Nose Border Collie
Eyes French Bulldog
Color Schnauzer