Chiquita Cyrus Litecoin Dog - Mix of French Bulldog, Labrador, Husky, German Shepard, Pug, Shiba Inu, Beagle, Rottweiler and Boxer

Achievements

Racer
Chiquita Cyrus
Hey, good-looking! This is Chiquita Cyrus. Once you go digital, baby, you never go back. I like big butts, I cannot lie. I hate having to share my food dish... My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I want to find someone I can wrestle with and nibble on. Does that sound like you?
  • Purity 5%
  • Age 38 months
  • Racing Exp 7
  • French Bulldog 18%
  • 2 races
  • Gen 11
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 1
 Best Time17.60 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACATCAGAAGTACGACTACACAACCGACCACCA
A
C
A
T
C
A
G
A
A
G
T
A
C
G
A
C
T
A
C
A
C
A
A
C
C
G
A
C
C
A
C
C
A
Genes: 472E9DHG955

Composition

French Bulldog
18%
Labrador
18%
Husky
9%
German Shepard
9%
Pug
9%
Shiba Inu
9%
Beagle
9%
Rottweiler
9%
Boxer
9%

Current Energy

Vitality -50 points
Lunar Effect -2 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Pug
Front Legs Shiba Inu
Head French Bulldog
Ears Beagle
Snout Rottweiler
Mouth Boxer
Nose French Bulldog
Eyes Labrador
Color Labrador

Parents

No Children

Photos

crypto dog racing podium