Chiquita Cyrus Litecoin Dog - Mix of French Bulldog, Labrador, Husky, German Shepard, Pug, Shiba Inu, Beagle, Rottweiler and Boxer
Chiquita Cyrus
  • Purity 5%
  • Age 71 months
  • Racing Exp 1
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 11
Depressed & Snaillike

Achievements

Racer

Bio

Hey, good-looking! This is Chiquita Cyrus. Once you go digital, baby, you never go back. I like big butts, I cannot lie. I hate having to share my food dish... My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I want to find someone I can wrestle with and nibble on. Does that sound like you?

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time18.37 sec
No rank  RacingĀ *** Pts
0.0% wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACATCAGAAGTACGACTACACAACCGACCACCA
A
C
A
T
C
A
G
A
A
G
T
A
C
G
A
C
T
A
C
A
C
A
A
C
C
G
A
C
C
A
C
C
A
Genes: 472E9DHG955

Composition

French Bulldog
18%
Labrador
18%
Husky
9%
German Shepard
9%
Pug
9%
Shiba Inu
9%
Beagle
9%
Rottweiler
9%
Boxer
9%

Current Energy

Vitality -50 points
Lunar Effect +2 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Pug
Front Legs Shiba Inu
Head French Bulldog
Ears Beagle
Snout Rottweiler
Mouth Boxer
Nose French Bulldog
Eyes Labrador
Color Labrador

Parents

No Children

Photos

Gift