Floyd Frodo Crypto Dog - Mix of German Shepard, St. Bernard, Grey Wolf, Rottweiler and French Bulldog
Floyd Frodo
  • Purity 29%
  • Age 32 months
  • Racing Exp 59
  • German Shepard 55%
  • Gold medal 1 Silver medal 3 Bronze medal 3
  • 19 races
  • Gen 6
Depressed & Snaillike

Achievements

Racer
Podium Champion
Speed Champion

Bio

Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I hate it when I am not the center of attention. I have a crush on the Grumpy cat. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I just want a snuggle buddy with a nice, soft coat.

Racing Stats

Ran 19 races
  • 1 3 3
 Best Time13.68 sec
No rank  RacingĀ *** Pts
36.8 % wins (7) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCATCATCACCCTCACACTGATCATCACGATGA
T
C
A
T
C
A
T
C
A
C
C
C
T
C
A
C
A
C
T
G
A
T
C
A
T
C
A
C
G
A
T
G
A
Genes: 777L7HB779B

Composition

German Shepard
55%
St. Bernard
18%
Grey Wolf
9%
Rottweiler
9%
French Bulldog
9%

Current Energy

Vitality +7 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs Grey Wolf
Head German Shepard
Ears Rottweiler
Snout St. Bernard
Mouth German Shepard
Nose German Shepard
Eyes French Bulldog
Color St. Bernard

Parents

No Children

Photos

virtual pet race virtual pet racing photo online dog racing Litecoin dog race photo Litecoin dog racing online dog racing crypto dog race
Gift