Tesla Toni Litecoin Game Dog - Mix of German Shepard, Husky, Golder Retriever, Shiba Inu, Pitbull terrier, Boxer and Border Collie

Achievements

Racer
Podium Champion
Tesla Toni
Hey there! Baby, call me Tesla Toni. As a good digital dog, my humans give me virtually everything. I'd like to help you shed your coat, baby. I hate being left alone all day. Air Bud is definitely my favorite movie. What a role model! I'll outrun you for the ball if I can...that's just how I roll.
  • Purity 12%
  • Age 42 months
  • Racing Exp 37
  • German Shepard 36%
  • 8 races
  • Gen 3
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 1 2 2
 Best Time15.12 sec
No rank  Racing *** Coins
62.5 % wins (5) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATCAACAAGATCAGTATCCTCATCAAACTAC
A
C
A
T
C
A
A
C
A
A
G
A
T
C
A
G
T
A
T
C
C
T
C
A
T
C
A
A
A
C
T
A
C
Genes: 47487EN77GJ

Composition

German Shepard
36%
Husky
18%
Golder Retriever
9%
Shiba Inu
9%
Pitbull terrier
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality -5 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Husky
Front Legs Golder Retriever
Head German Shepard
Ears Shiba Inu
Snout Pitbull terrier
Mouth German Shepard
Nose German Shepard
Eyes Boxer
Color Border Collie