Bolt Brigadier Cryptocurrency Dog - Mix of Shiba Inu, Husky, German Shepard, Golder Retriever, Rottweiler, Yorkshire Terrier and Boxer

Achievements

Racer
Speed Champion
Bolt Brigadier
I enjoy staying active, and running circles around puppies and young children. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. Sometimes I forget where I buried my bone. If we can run as a pack for a while, I'm open to that.
  • Purity 9%
  • Age 40 months
  • Racing Exp 54
  • Shiba Inu 27%
  • 20 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 2 0 4
20 races    Best Time13.68 sec
Rank 93  Racing *** Coins
30.0 % wins (6) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATCAACAAGAGTAGTACACTCATTAAACGTA
A
C
A
T
C
A
A
C
A
A
G
A
G
T
A
G
T
A
C
A
C
T
C
A
T
T
A
A
A
C
G
T
A
Genes: 4748EEH7FGE

Composition

Shiba Inu
27%
Husky
18%
German Shepard
18%
Golder Retriever
9%
Rottweiler
9%
Yorkshire Terrier
9%
Boxer
9%

Current Energy

Vitality -10 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Husky
Front Legs Golder Retriever
Head Shiba Inu
Ears Shiba Inu
Snout Rottweiler
Mouth German Shepard
Nose Yorkshire Terrier
Eyes Boxer
Color Shiba Inu