Stormy Saber Bitcoin Dog - Mix of Shiba Inu, Husky, German Shepard, Labrador BK, Labrador, Yorkshire Terrier and Boxer
Stormy Saber
  • Purity 12%
  • Age 16 months
  • Racing Exp 21
  • Shiba Inu 36%
  • Gold medal 1 Silver medal 1 Bronze medal 1
  • 3 races
  • Gen 5
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

I could spend days on end chasing my tail. I get so close but it's just so fast! I don't like having to stay in the car when my people go inside. Spiked dog collars really turn me on. I love waking up early then indulging in long afternoon naps. I want a mate that knows how to give a proper belly rub!

Racing Stats

Ran 3 races
  • 1 1 1
 Best Time15.63 sec
Rank 72  RacingĀ *** Pts
100.0 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACATCAACAGCAGTAGTACCAGTATTAAACGTA
A
C
A
T
C
A
A
C
A
G
C
A
G
T
A
G
T
A
C
C
A
G
T
A
T
T
A
A
A
C
G
T
A
Genes: 4746EE5EFGE

Composition

Shiba Inu
36%
Husky
18%
German Shepard
9%
Labrador BK
9%
Labrador
9%
Yorkshire Terrier
9%
Boxer
9%

Current Energy

Vitality -6 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Husky
Front Legs Labrador BK
Head Shiba Inu
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Yorkshire Terrier
Eyes Boxer
Color Shiba Inu

Parents

No Children

Photos

Litecoin pet racing podium virtual pet racing virtual doggy race photo
Gift