Stormy Saber Bitcoin Dog - Mix of Shiba Inu, Husky, German Shepard, Labrador BK, Labrador, Yorkshire Terrier and Boxer

Achievements

Racer
Podium Champion
Stormy Saber
I could spend days on end chasing my tail. I get so close but it's just so fast! I don't like having to stay in the car when my people go inside. Spiked dog collars really turn me on. I love waking up early then indulging in long afternoon naps. I want a mate that knows how to give a proper belly rub!
  • Purity 12%
  • Age 21 months
  • Racing Exp 46
  • Shiba Inu 36%
  • 9 races
  • Gen 5
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 2 3 1
9 races    Best Time15.63 sec
No rank  Racing *** Coins
66.7 % wins (6) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATCAACAGCAGTAGTACCAGTATTAAACGTA
A
C
A
T
C
A
A
C
A
G
C
A
G
T
A
G
T
A
C
C
A
G
T
A
T
T
A
A
A
C
G
T
A
Genes: 4746EE5EFGE

Composition

Shiba Inu
36%
Husky
18%
German Shepard
9%
Labrador BK
9%
Labrador
9%
Yorkshire Terrier
9%
Boxer
9%

Current Energy

Vitality -6 points
Lunar Effect -12 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Husky
Front Legs Labrador BK
Head Shiba Inu
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Yorkshire Terrier
Eyes Boxer
Color Shiba Inu