Stormy Saber Bitcoin Dog - Mix of Shiba Inu, Husky, German Shepard, Labrador BK, Labrador, Yorkshire Terrier and Boxer

Achievements

Podium Champion
Pro Racer
Master Champion
Stormy Saber
I could spend days on end chasing my tail. I get so close but it's just so fast! I don't like having to stay in the car when my people go inside. Spiked dog collars really turn me on. I love waking up early then indulging in long afternoon naps. I want a mate that knows how to give a proper belly rub!
  • Purity 12%
  • Age 18 months
  • Racing Exp 79
  • Shiba Inu 36%
  • 17 races
  • Gen 5
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

17 races   |
  • 4 4 2
 Best Time14.78 sec
No rank  Racing *** Pts
58.8 % wins (10) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACATCAACAGCAGTAGTACCAGTATTAAACGTA
A
C
A
T
C
A
A
C
A
G
C
A
G
T
A
G
T
A
C
C
A
G
T
A
T
T
A
A
A
C
G
T
A
Genes: 4746EE5EFGE

Composition

Shiba Inu
36%
Husky
18%
German Shepard
9%
Labrador BK
9%
Labrador
9%
Yorkshire Terrier
9%
Boxer
9%

Current Energy

Vitality -6 points
Lunar Effect +8 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Husky
Front Legs Labrador BK
Head Shiba Inu
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Yorkshire Terrier
Eyes Boxer
Color Shiba Inu