Libby Lady Rover Digital Cryptocurrency Dog - Mix of Shiba Inu, Labrador, Schnauzer, German Shepard, Labrador BK, Beagle and Yorkshire Terrier

Achievements

Podium Champion
Pro Racer
Master Champion
Libby Lady Rover
My favorite position is doggie style ;) I like giving wet kisses. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I'll eat my vomit and yours too. Getting out of a long relationship, not looking for another
  • Purity 12%
  • Age 23 months
  • Racing Exp 71
  • Shiba Inu 36%
  • 14 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

14 races   |
  • 2 3 5
 Best Time15.22 sec
No rank  Racing *** Pts
71.4 % wins (10) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAATATCAGCAGTAGTACCAGTACCACTATTA
G
T
A
A
T
A
T
C
A
G
C
A
G
T
A
G
T
A
C
C
A
G
T
A
C
C
A
C
T
A
T
T
A
Genes: EC76EE5E5DF

Composition

Shiba Inu
36%
Labrador
18%
Schnauzer
9%
German Shepard
9%
Labrador BK
9%
Beagle
9%
Yorkshire Terrier
9%

Current Energy

Vitality -10 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Schnauzer
Legs German Shepard
Front Legs Labrador BK
Head Shiba Inu
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Labrador
Eyes Beagle
Color Yorkshire Terrier