Sammy Shiner Digital Cryptocurrency Dog - Mix of Shiba Inu and Labrador

Achievements

Racer
Sammy Shiner
How do you do? I'm Sammy Shiner. Have you ever dated a digital creation before? I may need de-worming. My bark alone scares birds out of my yard. If you enjoy growling through fences as much as I do, we should get together. I hate it when humans put the lid down.
  • Purity 82%
  • Age 18 months
  • Racing Exp 42
  • Shiba Inu 91%
  • 15 races
  • Gen 7
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

15 races   |
  • 3 1 0
 Best Time16.02 sec
No rank  Racing *** Pts
26.7 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTAGTAGTAGTACCAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
C
C
A
G
T
A
G
T
A
Genes: EEEEEEEE5EE

Composition

Shiba Inu
91%
Labrador
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Shiba Inu
Nose Labrador
Eyes Shiba Inu
Color Shiba Inu