Sammy Shiner Digital Cryptocurrency Dog - Mix of Shiba Inu and Labrador
Sammy Shiner
  • Purity 82%
  • Age 16 months
  • Racing Exp 18
  • Shiba Inu 91%
  • Gold medal 2 Silver medal 0 Bronze medal 0
  • 4 races
  • Gen 7
Depressed & Snaillike

Achievements

Racer

Bio

How do you do? I'm Sammy Shiner. Have you ever dated a digital creation before? I may need de-worming. My bark alone scares birds out of my yard. If you enjoy growling through fences as much as I do, we should get together. I hate it when humans put the lid down.

Racing Stats

Ran 4 races
  • 2 0 0
 Best Time16.02 sec
No rank  RacingĀ *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTAGTAGTAGTACCAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
C
C
A
G
T
A
G
T
A
Genes: EEEEEEEE5EE

Composition

Shiba Inu
91%
Labrador
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Shiba Inu
Nose Labrador
Eyes Shiba Inu
Color Shiba Inu