Cassie Cage Chevy Litecoin Dog - Mix of Shiba Inu and Beagle

Achievements

None
Cassie Cage Chevy
Hey dawg! I'm Cassie Cage Chevy. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I live life by my favorite quote "Every dog has it's day", but every day is my day! I'm looking to share time together and not just to be an accessory.
  • Purity 82%
  • Age 52 months
  • Racing Exp 0
  • Shiba Inu 91%
  • 0 races
  • Gen 6
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTACTAGTAGTAGTAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
C
T
A
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
Genes: EEEEEDEEEEE

Composition

Shiba Inu
91%
Beagle
9%

Current Energy

Vitality -38 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu