Patty Pokey Crypto Dog - Mix of Shiba Inu, Yorkshire Terrier, Beagle and Rottweiler

Achievements

Racer
Patty Pokey
What's your favorite bed? Mine is the dirty laundry. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I'm willing to try little bondage, so my human chained me up!
  • Purity 52%
  • Age 38 months
  • Racing Exp 6
  • Shiba Inu 73%
  • 1 races
  • Gen 5
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 1
 Best Time16.55 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: GTAGTAGTAGTATTACTAGTACACGTAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
T
T
A
C
T
A
G
T
A
C
A
C
G
T
A
G
T
A
G
T
A
Genes: EEEEFDEHEEE

Composition

Shiba Inu
73%
Yorkshire Terrier
9%
Beagle
9%
Rottweiler
9%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears Beagle
Snout Shiba Inu
Mouth Rottweiler
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu