Grady Griffen Bitcoin Dog - Mix of Shiba Inu, Beagle, Yorkshire Terrier and Grey Wolf

Achievements

None
Grady Griffen
It's a barkin' beautiful day! Grady Griffen here. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I'm looking for a hard-working service animal who can keep up with me.
  • Purity 39%
  • Age 40 months
  • Racing Exp 0
  • Shiba Inu 64%
  • 0 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGTAGTAGTATTACTAGTACCCGTAGTACTA
G
T
A
G
T
A
G
T
A
G
T
A
T
T
A
C
T
A
G
T
A
C
C
C
G
T
A
G
T
A
C
T
A
Genes: EEEEFDELEED

Composition

Shiba Inu
64%
Beagle
18%
Yorkshire Terrier
9%
Grey Wolf
9%

Current Energy

Vitality -45 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Yorkshire Terrier
Ears Beagle
Snout Shiba Inu
Mouth Grey Wolf
Nose Shiba Inu
Eyes Shiba Inu
Color Beagle