Fletcher Finn Litecoin Game Dog - Mix of Shiba Inu, Beagle, Grey Wolf and Pitbull terrier

Achievements

None
Fletcher Finn
Hello, I'm Fletcher Finn. How's it goin'? My AI may be artificial, but at least I'm intelligent. Oh, go ahead. Pet me. I know you want to. I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 39%
  • Age 40 months
  • Racing Exp 0
  • Shiba Inu 64%
  • 0 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTACTAGTACCCGTATCCCTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
C
T
A
G
T
A
C
C
C
G
T
A
T
C
C
C
T
A
Genes: EEEEEDELEND

Composition

Shiba Inu
64%
Beagle
18%
Grey Wolf
9%
Pitbull terrier
9%

Current Energy

Vitality -43 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Grey Wolf
Nose Shiba Inu
Eyes Pitbull terrier
Color Beagle