Elena Elmo Digital Cryptocurrency Dog - Mix of Shiba Inu, Beagle, German Shepard, Labrador BK and Rottweiler

Achievements

None
Elena Elmo
Here in cyberspace, I ain't got much use for a floppy disc. The place I like most in the world is curled up in my human's bed, hogging all the covers! I like to work out by digging fresh holes in landscaped yards. I'm a serial monogamist. I don't understand why my human tries to give me tap water. I expect filtered and distilled!
  • Purity 29%
  • Age 41 months
  • Racing Exp 0
  • Shiba Inu 55%
  • 0 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGTAGTAGTAGTACTAGTAGCAGTACACCTA
T
C
A
G
T
A
G
T
A
G
T
A
G
T
A
C
T
A
G
T
A
G
C
A
G
T
A
C
A
C
C
T
A
Genes: 7EEEEDE6EHD

Composition

Shiba Inu
55%
Beagle
18%
German Shepard
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -31 points
Lunar Effect +18 points

Traits Breakdown

Body German Shepard
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Beagle
Snout Shiba Inu
Mouth Labrador BK
Nose Shiba Inu
Eyes Rottweiler
Color Beagle