Chico Chief Bitcoin Dog - Mix of Shiba Inu, Poodle, Beagle, Maltese, German Shepard, Boxer, Golder Retriever and Border Collie

Achievements

Racer
Chico Chief
Salutations! My name's Chico Chief. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) Size doesn't matter, I like 'em all. People food disagrees with me. Whew! You can tell. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays.
  • Purity 4%
  • Age 41 months
  • Racing Exp 7
  • Shiba Inu 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
1 races    Best Time14.67 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGACGTAACCTCAAACGACCTAAGATACCTA
G
T
A
G
A
C
G
T
A
A
C
C
T
C
A
A
A
C
G
A
C
C
T
A
A
G
A
T
A
C
C
T
A
Genes: EIEK7GID8JD

Composition

Shiba Inu
18%
Poodle
18%
Beagle
18%
Maltese
9%
German Shepard
9%
Boxer
9%
Golder Retriever
9%
Border Collie
9%

Current Energy

Vitality -41 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail Poodle
Legs Shiba Inu
Front Legs Maltese
Head German Shepard
Ears Boxer
Snout Poodle
Mouth Beagle
Nose Golder Retriever
Eyes Border Collie
Color Beagle