Knuckles Kyra Litecoin Dog - Mix of Beagle, Shiba Inu, Maltese, Labrador, Boxer, Rottweiler and German Shepard
Knuckles Kyra
  • Purity 7%
  • Age 37 months
  • Racing Exp 37
  • Beagle 27%
  • Gold medal 1 Silver medal 2 Bronze medal 2
  • 8 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

I hate it when I am not the center of attention. I think hamsters and cats are both over-rated. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I enjoy crunchy kibble and drinking from toilets.

Racing Stats

Ran 8 races
  • 1 2 2
 Best Time15.52 sec
No rank  RacingĀ *** Pts
62.5 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GTACCAGTAACCCTAAACCACCTAACCTCACTA
G
T
A
C
C
A
G
T
A
A
C
C
C
T
A
A
A
C
C
A
C
C
T
A
A
C
C
T
C
A
C
T
A
Genes: E5EKDGHDK7D

Composition

Beagle
27%
Shiba Inu
18%
Maltese
18%
Labrador
9%
Boxer
9%
Rottweiler
9%
German Shepard
9%

Current Energy

Vitality -65 points
Lunar Effect -6 points

Traits Breakdown

Body Shiba Inu
Tail Labrador
Legs Shiba Inu
Front Legs Maltese
Head Beagle
Ears Boxer
Snout Rottweiler
Mouth Beagle
Nose Maltese
Eyes German Shepard
Color Beagle