Knuckles Kyra Litecoin Dog - Mix of Beagle, Shiba Inu, Maltese, Labrador, Boxer, Rottweiler and German Shepard

Achievements

Racer
Knuckles Kyra
I hate it when I am not the center of attention. I think hamsters and cats are both over-rated. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I enjoy crunchy kibble and drinking from toilets.
  • Purity 7%
  • Age 41 months
  • Racing Exp 29
  • Beagle 27%
  • 7 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 2 2
7 races    Best Time15.52 sec
No rank  Racing *** Coins
57.1 % wins (4) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTACCAGTAACCCTAAACCACCTAACCTCACTA
G
T
A
C
C
A
G
T
A
A
C
C
C
T
A
A
A
C
C
A
C
C
T
A
A
C
C
T
C
A
C
T
A
Genes: E5EKDGHDK7D

Composition

Beagle
27%
Shiba Inu
18%
Maltese
18%
Labrador
9%
Boxer
9%
Rottweiler
9%
German Shepard
9%

Current Energy

Vitality -65 points
Lunar Effect +10 points

Traits Breakdown

Body Shiba Inu
Tail Labrador
Legs Shiba Inu
Front Legs Maltese
Head Beagle
Ears Boxer
Snout Rottweiler
Mouth Beagle
Nose Maltese
Eyes German Shepard
Color Beagle