Lexi Lewis Bitcoin Dog - Mix of Maltese, French Bulldog, German Shepard, St. Bernard, Labrador, Beagle, Rottweiler and Dachshund

Achievements

Racer
Lexi Lewis
Hey there... I'm Lexi Lewis. I live in cyberspace where you can turn me on. I don't understand why my human tries to give me tap water. I expect filtered and distilled! My favorite way to relax is to be scratched on my belly. Let me have a pig's ear and I'm in heaven.
  • Purity 4%
  • Age 40 months
  • Racing Exp 4
  • Maltese 18%
  • 4 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
4 races    Best Time15.62 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGACCAACCCGACTATCACACCGAACCTCAGGA
T
G
A
C
C
A
A
C
C
C
G
A
C
T
A
T
C
A
C
A
C
C
G
A
A
C
C
T
C
A
G
G
A
Genes: B5K9D7H9K7A

Composition

Maltese
18%
French Bulldog
18%
German Shepard
18%
St. Bernard
9%
Labrador
9%
Beagle
9%
Rottweiler
9%
Dachshund
9%

Current Energy

Vitality -81 points
Lunar Effect -2 points

Traits Breakdown

Body St. Bernard
Tail Labrador
Legs Maltese
Front Legs French Bulldog
Head Beagle
Ears German Shepard
Snout Rottweiler
Mouth French Bulldog
Nose Maltese
Eyes German Shepard
Color Dachshund