Lilo Latte Crypto Dog - Mix of Maltese, German Shepard, St. Bernard, Beagle, Rottweiler and French Bulldog

Achievements

Racer
Lilo Latte
Suh? How's it goin? I'm Lilo Latte. In the big data server, I sorta rule. I could spend days on end chasing my tail. I get so close but it's just so fast! I don't understand why my human tries to give me tap water. I expect filtered and distilled! Too much steak gives me the runs!
  • Purity 20%
  • Age 18 months
  • Racing Exp 41
  • Maltese 45%
  • 20 races
  • Gen 4
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

20 races   |
  • 0 1 3
 Best Time15.75 sec
No rank  Racing *** Pts
20.0 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGAACCACCACCCTATCACACCGAACCTCAACC
T
G
A
A
C
C
A
C
C
A
C
C
C
T
A
T
C
A
C
A
C
C
G
A
A
C
C
T
C
A
A
C
C
Genes: BKKKD7H9K7K

Composition

Maltese
45%
German Shepard
18%
St. Bernard
9%
Beagle
9%
Rottweiler
9%
French Bulldog
9%

Current Energy

Vitality -91 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail Maltese
Legs Maltese
Front Legs Maltese
Head Beagle
Ears German Shepard
Snout Rottweiler
Mouth French Bulldog
Nose Maltese
Eyes German Shepard
Color Maltese

Parents

No Children

Photos

crypto dog racing photo virtual dog racing photo online doggy racing online canine racing