Lilo Latte Crypto Dog - Mix of Maltese, German Shepard, St. Bernard, Beagle, Rottweiler and French Bulldog
Lilo Latte
  • Purity 20%
  • Age 16 months
  • Racing Exp 1
  • Maltese 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 4
Depressed & Snaillike

Achievements

Racer

Bio

Suh? How's it goin? I'm Lilo Latte. In the big data server, I sorta rule. I could spend days on end chasing my tail. I get so close but it's just so fast! I don't understand why my human tries to give me tap water. I expect filtered and distilled! Too much steak gives me the runs!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.85 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TGAACCACCACCCTATCACACCGAACCTCAACC
T
G
A
A
C
C
A
C
C
A
C
C
C
T
A
T
C
A
C
A
C
C
G
A
A
C
C
T
C
A
A
C
C
Genes: BKKKD7H9K7K

Composition

Maltese
45%
German Shepard
18%
St. Bernard
9%
Beagle
9%
Rottweiler
9%
French Bulldog
9%

Current Energy

Vitality -91 points
Lunar Effect 0 points

Traits Breakdown

Body St. Bernard
Tail Maltese
Legs Maltese
Front Legs Maltese
Head Beagle
Ears German Shepard
Snout Rottweiler
Mouth French Bulldog
Nose Maltese
Eyes German Shepard
Color Maltese

Parents

No Children

Photos

Gift