Lilo Latte Crypto Dog - Mix of Maltese, German Shepard, St. Bernard, Beagle, Rottweiler and French Bulldog

Achievements

Racer
Lilo Latte
Suh? How's it goin? I'm Lilo Latte. In the big data server, I sorta rule. I could spend days on end chasing my tail. I get so close but it's just so fast! I don't understand why my human tries to give me tap water. I expect filtered and distilled! Too much steak gives me the runs!
  • Purity 20%
  • Age 21 months
  • Racing Exp 7
  • Maltese 45%
  • 2 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
2 races    Best Time16.85 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGAACCACCACCCTATCACACCGAACCTCAACC
T
G
A
A
C
C
A
C
C
A
C
C
C
T
A
T
C
A
C
A
C
C
G
A
A
C
C
T
C
A
A
C
C
Genes: BKKKD7H9K7K

Composition

Maltese
45%
German Shepard
18%
St. Bernard
9%
Beagle
9%
Rottweiler
9%
French Bulldog
9%

Current Energy

Vitality -91 points
Lunar Effect +12 points

Traits Breakdown

Body St. Bernard
Tail Maltese
Legs Maltese
Front Legs Maltese
Head Beagle
Ears German Shepard
Snout Rottweiler
Mouth French Bulldog
Nose Maltese
Eyes German Shepard
Color Maltese