Maddux Miko Litecoin Game Dog - Mix of Beagle, Shiba Inu, Maltese, Husky, Boxer, Yorkshire Terrier and Golder Retriever
Maddux Miko
  • Purity 9%
  • Age 13 months
  • Racing Exp 0
  • Beagle 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

Someday I'm gonna breakout from inside this server. Slipping my collar, running off and making my humans worried? Every chance I get. I may need de-worming. I don't like having to stay off the furniture. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GTACTAACAACCGTAACCCTACTAAACTTAAGA
G
T
A
C
T
A
A
C
A
A
C
C
G
T
A
A
C
C
C
T
A
C
T
A
A
A
C
T
T
A
A
G
A
Genes: ED4KEKDDGF8

Composition

Beagle
27%
Shiba Inu
18%
Maltese
18%
Husky
9%
Boxer
9%
Yorkshire Terrier
9%
Golder Retriever
9%

Current Energy

Vitality -43 points
Lunar Effect +6 points

Traits Breakdown

Body Shiba Inu
Tail Beagle
Legs Husky
Front Legs Maltese
Head Shiba Inu
Ears Maltese
Snout Beagle
Mouth Beagle
Nose Boxer
Eyes Yorkshire Terrier
Color Golder Retriever

Parents

No Children

Gift