Maddux Miko Litecoin Game Dog - Mix of Beagle, Shiba Inu, Maltese, Husky, Boxer, Yorkshire Terrier and Golder Retriever

Achievements

Podium Champion
Pro Racer
Master Champion
Maddux Miko
Someday I'm gonna breakout from inside this server. Slipping my collar, running off and making my humans worried? Every chance I get. I may need de-worming. I don't like having to stay off the furniture. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them!
  • Purity 9%
  • Age 18 months
  • Racing Exp 101
  • Beagle 27%
  • 26 races
  • Gen 2
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

26 races   |
  • 3 4 6
 Best Time14.82 sec
No rank  Racing *** Pts
50.0 % wins (13) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTACTAACAACCGTAACCCTACTAAACTTAAGA
G
T
A
C
T
A
A
C
A
A
C
C
G
T
A
A
C
C
C
T
A
C
T
A
A
A
C
T
T
A
A
G
A
Genes: ED4KEKDDGF8

Composition

Beagle
27%
Shiba Inu
18%
Maltese
18%
Husky
9%
Boxer
9%
Yorkshire Terrier
9%
Golder Retriever
9%

Current Energy

Vitality -43 points
Lunar Effect +4 points

Traits Breakdown

Body Shiba Inu
Tail Beagle
Legs Husky
Front Legs Maltese
Head Shiba Inu
Ears Maltese
Snout Beagle
Mouth Beagle
Nose Boxer
Eyes Yorkshire Terrier
Color Golder Retriever

Parents

No Children

Photos

crypto doggy race results cryptocurrency doggy race podium cryptocurrency canine racing podium online doggy race results Bitcoin doggy race podium online canine race cryptocurrency dog race Litecoin dog racing photo