Mya Mouse Bitcoin Dog - Mix of Beagle, German Shepard, Husky, Grey Wolf, Shiba Inu, Maltese, St. Bernard, Boxer, Yorkshire Terrier and Golder Retriever
Mya Mouse
  • Purity 1%
  • Age 13 months
  • Racing Exp 8
  • Beagle 18%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Size matters. This dawg's into big databases. Those flying monkeys in the Wizard of Oz still scare me! My bark alone scares birds out of my yard. I absolutely love long walks when I can stop and smell the bushes. Just looking to sow some wild oats here...

Racing Stats

Ran 1 races
  • 1 0 0
 Best Time14.30 sec
No rank  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCACTAACACCCGTAACCCTATGAAACTTAAGA
T
C
A
C
T
A
A
C
A
C
C
C
G
T
A
A
C
C
C
T
A
T
G
A
A
A
C
T
T
A
A
G
A
Genes: 7D4LEKDBGF8

Composition

Beagle
18%
German Shepard
9%
Husky
9%
Grey Wolf
9%
Shiba Inu
9%
Maltese
9%
St. Bernard
9%
Boxer
9%
Yorkshire Terrier
9%
Golder Retriever
9%

Current Energy

Vitality -6 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Husky
Front Legs Grey Wolf
Head Shiba Inu
Ears Maltese
Snout Beagle
Mouth St. Bernard
Nose Boxer
Eyes Yorkshire Terrier
Color Golder Retriever