Avalon Amethyst Bitcoin Dog - Mix of Grey Wolf, Rottweiler, Husky, Beagle, Labrador BK, Maltese, Dachshund, St. Bernard, Boxer, Schnauzer and Golder Retriever

Achievements

Racer
Podium Champion
Avalon Amethyst
Salutations! My name's Avalon Amethyst. The internet's my home. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Removing excess stuffing from pillows is my favorite hobby. I have a crush on the Grumpy cat. Looking for that special tail wag.
  • Purity 0%
  • Age 21 months
  • Racing Exp 24
  • Mixed-breed
  • 6 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 1
6 races    Best Time15.45 sec
Rank 94  Racing *** Coins
50.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCACACACTAGCAACCGGATGAAACATAAGA
C
C
C
C
A
C
A
C
A
C
T
A
G
C
A
A
C
C
G
G
A
T
G
A
A
A
C
A
T
A
A
G
A
Genes: LH4D6KABGC8

Composition

Grey Wolf
9%
Rottweiler
9%
Husky
9%
Beagle
9%
Labrador BK
9%
Maltese
9%
Dachshund
9%
St. Bernard
9%
Boxer
9%
Schnauzer
9%
Golder Retriever
9%

Current Energy

Vitality -30 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail Rottweiler
Legs Husky
Front Legs Beagle
Head Labrador BK
Ears Maltese
Snout Dachshund
Mouth St. Bernard
Nose Boxer
Eyes Schnauzer
Color Golder Retriever

Parents

Children

Photos

online dog race podium online pet racing virtual pet racing podium Bitcoin doggy race photo Litecoin pet race podium online pet race crypto doggy race photo crypto dog race