Avalon Amethyst Bitcoin Dog - Mix of Grey Wolf, Rottweiler, Husky, Beagle, Labrador BK, Maltese, Dachshund, St. Bernard, Boxer, Schnauzer and Golder Retriever

Achievements

Podium Champion
Pro Racer
Master Champion
Avalon Amethyst
Salutations! My name's Avalon Amethyst. The internet's my home. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Removing excess stuffing from pillows is my favorite hobby. I have a crush on the Grumpy cat. Looking for that special tail wag.
  • Purity 0%
  • Age 18 months
  • Racing Exp 95
  • Mixed-breed
  • 26 races
  • Gen 0
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

26 races   |
  • 6 2 3
 Best Time14.57 sec
No rank  Racing *** Pts
42.3 % wins (11) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCCACACACTAGCAACCGGATGAAACATAAGA
C
C
C
C
A
C
A
C
A
C
T
A
G
C
A
A
C
C
G
G
A
T
G
A
A
A
C
A
T
A
A
G
A
Genes: LH4D6KABGC8

Composition

Grey Wolf
9%
Rottweiler
9%
Husky
9%
Beagle
9%
Labrador BK
9%
Maltese
9%
Dachshund
9%
St. Bernard
9%
Boxer
9%
Schnauzer
9%
Golder Retriever
9%

Current Energy

Vitality -30 points
Lunar Effect -12 points

Traits Breakdown

Body Grey Wolf
Tail Rottweiler
Legs Husky
Front Legs Beagle
Head Labrador BK
Ears Maltese
Snout Dachshund
Mouth St. Bernard
Nose Boxer
Eyes Schnauzer
Color Golder Retriever

Parents

Children

Photos

cryptocurrency doggy racing Bitcoin dog race results online dog racing virtual doggy racing photo cryptocurrency pet racing photo Litecoin dog race results cryptocurrency doggy racing photo Litecoin canine racing podium