Avalon Amethyst Bitcoin Dog - Mix of Grey Wolf, Rottweiler, Husky, Beagle, Labrador BK, Maltese, Dachshund, St. Bernard, Boxer, Schnauzer and Golder Retriever
Avalon Amethyst
  • Purity 0%
  • Age 51 months
  • Racing Exp 34
  • Mixed-breed
  • Gold medal 2 Silver medal 1 Bronze medal 1
  • 9 races
  • Gen 0
Sad & Slothful

Achievements

Racer
Podium Champion

Bio

Salutations! My name's Avalon Amethyst. The internet's my home. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Removing excess stuffing from pillows is my favorite hobby. I have a crush on the Grumpy cat. Looking for that special tail wag.

Racing Stats

Ran 9 races
  • 2 1 1
 Best Time15.45 sec
Rank 57  RacingĀ *** Pts
44.4% wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCCACACACTAGCAACCGGATGAAACATAAGA
C
C
C
C
A
C
A
C
A
C
T
A
G
C
A
A
C
C
G
G
A
T
G
A
A
A
C
A
T
A
A
G
A
Genes: LH4D6KABGC8

Composition

Grey Wolf
9%
Rottweiler
9%
Husky
9%
Beagle
9%
Labrador BK
9%
Maltese
9%
Dachshund
9%
St. Bernard
9%
Boxer
9%
Schnauzer
9%
Golder Retriever
9%

Current Energy

Vitality -30 points
Lunar Effect +4 points

Traits Breakdown

Body Grey Wolf
Tail Rottweiler
Legs Husky
Front Legs Beagle
Head Labrador BK
Ears Maltese
Snout Dachshund
Mouth St. Bernard
Nose Boxer
Eyes Schnauzer
Color Golder Retriever

Parents

Children

Photos

Litecoin dog racing cryptocurrency dog racing Bitcoin dog race photo cryptocurrency doggy race
Gift