Benji Bernie Bitcoin Game Dog - Mix of German Shepard, Beagle, Yorkshire Terrier, Grey Wolf, Shiba Inu, Dachshund, Labrador BK and Husky
Benji Bernie
  • Purity 4%
  • Age 15 months
  • Racing Exp 8
  • German Shepard 18%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I make the best virtual pet. I'd like to help you shed your coat, baby. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house?

Racing Stats

Ran 1 races
  • 1 0 0
 Best Time15.17 sec
No rank  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCACTATCACCCGTATTACTAGGAGCATTAACA
T
C
A
C
T
A
T
C
A
C
C
C
G
T
A
T
T
A
C
T
A
G
G
A
G
C
A
T
T
A
A
C
A
Genes: 7D7LEFDA6F4

Composition

German Shepard
18%
Beagle
18%
Yorkshire Terrier
18%
Grey Wolf
9%
Shiba Inu
9%
Dachshund
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality -3 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs German Shepard
Front Legs Grey Wolf
Head Shiba Inu
Ears Yorkshire Terrier
Snout Beagle
Mouth Dachshund
Nose Labrador BK
Eyes Yorkshire Terrier
Color Husky