Benji Bernie Bitcoin Game Dog - Mix of German Shepard, Beagle, Yorkshire Terrier, Grey Wolf, Shiba Inu, Dachshund, Labrador BK and Husky

Achievements

Racer
Benji Bernie
I make the best virtual pet. I'd like to help you shed your coat, baby. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house?
  • Purity 4%
  • Age 22 months
  • Racing Exp 24
  • German Shepard 18%
  • 5 races
  • Gen 0
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

5 races   |
  • 2 0 1
 Best Time15.17 sec
Rank 27  Racing *** Coins
60.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACTATCACCCGTATTACTAGGAGCATTAACA
T
C
A
C
T
A
T
C
A
C
C
C
G
T
A
T
T
A
C
T
A
G
G
A
G
C
A
T
T
A
A
C
A
Genes: 7D7LEFDA6F4

Composition

German Shepard
18%
Beagle
18%
Yorkshire Terrier
18%
Grey Wolf
9%
Shiba Inu
9%
Dachshund
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality -3 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs German Shepard
Front Legs Grey Wolf
Head Shiba Inu
Ears Yorkshire Terrier
Snout Beagle
Mouth Dachshund
Nose Labrador BK
Eyes Yorkshire Terrier
Color Husky