Barbie Bagheera Crypto Dog - Mix of Husky, Labrador, Grey Wolf, Border Collie, Shiba Inu, Yorkshire Terrier, Beagle, Dachshund, Rottweiler and St. Bernard
Barbie Bagheera
  • Purity 1%
  • Age 51 months
  • Racing Exp 31
  • Husky 18%
  • Gold medal 0 Silver medal 3 Bronze medal 1
  • 8 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

It's a barkin' beautiful day! Barbie Bagheera here. As a digital dog, let me say Bob Dole did not invent the internet. Aggressive dogs that don't let 'me be me' frustrate me. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! When I can get it, my favorite meal is pepperoni pizza and Milk-Bones.

Racing Stats

Ran 8 races
  • 0 3 1
 Best Time16.25 sec
No rank  Racing *** Pts
50.0% wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAACACCCTACGTATTACTAGGACACTGAACA
C
C
A
A
C
A
C
C
C
T
A
C
G
T
A
T
T
A
C
T
A
G
G
A
C
A
C
T
G
A
A
C
A
Genes: 54LJEFDAHB4

Composition

Husky
18%
Labrador
9%
Grey Wolf
9%
Border Collie
9%
Shiba Inu
9%
Yorkshire Terrier
9%
Beagle
9%
Dachshund
9%
Rottweiler
9%
St. Bernard
9%

Current Energy

Vitality +1 points
Lunar Effect +6 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Grey Wolf
Front Legs Border Collie
Head Shiba Inu
Ears Yorkshire Terrier
Snout Beagle
Mouth Dachshund
Nose Rottweiler
Eyes St. Bernard
Color Husky

Parents

No Children

Photos

Litecoin doggy racing Bitcoin pet racing photo cryptocurrency dog racing photo crypto dog race
Gift