Barbie Bagheera Crypto Dog - Mix of Husky, Labrador, Grey Wolf, Border Collie, Shiba Inu, Yorkshire Terrier, Beagle, Dachshund, Rottweiler and St. Bernard

Achievements

Racer
Barbie Bagheera
It's a barkin' beautiful day! Barbie Bagheera here. As a digital dog, let me say Bob Dole did not invent the internet. Aggressive dogs that don't let 'me be me' frustrate me. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! When I can get it, my favorite meal is pepperoni pizza and Milk-Bones.
  • Purity 1%
  • Age 21 months
  • Racing Exp 17
  • Husky 18%
  • 10 races
  • Gen 1
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
10 races    Best Time15.40 sec
Rank 66  Racing *** Coins
10.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAACACCCTACGTATTACTAGGACACTGAACA
C
C
A
A
C
A
C
C
C
T
A
C
G
T
A
T
T
A
C
T
A
G
G
A
C
A
C
T
G
A
A
C
A
Genes: 54LJEFDAHB4

Composition

Husky
18%
Labrador
9%
Grey Wolf
9%
Border Collie
9%
Shiba Inu
9%
Yorkshire Terrier
9%
Beagle
9%
Dachshund
9%
Rottweiler
9%
St. Bernard
9%

Current Energy

Vitality +1 points
Lunar Effect +12 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Grey Wolf
Front Legs Border Collie
Head Shiba Inu
Ears Yorkshire Terrier
Snout Beagle
Mouth Dachshund
Nose Rottweiler
Eyes St. Bernard
Color Husky