Yin Yoda Litecoin Dog - Mix of Labrador, Husky, Grey Wolf, Border Collie, Dachshund, Shiba Inu, Golder Retriever, Rottweiler, St. Bernard and Corgi
Yin Yoda
  • Purity 1%
  • Age 14 months
  • Racing Exp 109
  • Labrador 18%
  • Gold medal 8 Silver medal 2 Bronze medal 3
  • 26 races
  • Gen 0
Ecstatic & Fast

Achievements

Podium Champion
Pro Racer
Master Champion

Bio

Well hello, beautiful. My name's Yin Yoda. I like nibbling on most everything, but I'll bite if you want me to. I believe running along the beach to catch a stick can be nearly orgasmic. I'm totally against baths! They are the worst! I've always wanted to be in commercials and be treated as the star I am!

Racing Stats

Ran 26 races
  • 8 2 3
 Best Time15.28 sec
Rank 33  RacingĀ *** Pts
50.0 % wins (13) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAACACCCTACGGACCAGTAAGACACTGAAGC
C
C
A
A
C
A
C
C
C
T
A
C
G
G
A
C
C
A
G
T
A
A
G
A
C
A
C
T
G
A
A
G
C
Genes: 54LJA5E8HBO

Composition

Labrador
18%
Husky
9%
Grey Wolf
9%
Border Collie
9%
Dachshund
9%
Shiba Inu
9%
Golder Retriever
9%
Rottweiler
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -6 points
Lunar Effect +8 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Grey Wolf
Front Legs Border Collie
Head Dachshund
Ears Labrador
Snout Shiba Inu
Mouth Golder Retriever
Nose Rottweiler
Eyes St. Bernard
Color Corgi