Yin Yoda Litecoin Dog - Mix of Labrador, Husky, Grey Wolf, Border Collie, Dachshund, Shiba Inu, Golder Retriever, Rottweiler, St. Bernard and Corgi

Achievements

Podium Champion
Pro Racer
Master Champion
Yin Yoda
Well hello, beautiful. My name's Yin Yoda. I like nibbling on most everything, but I'll bite if you want me to. I believe running along the beach to catch a stick can be nearly orgasmic. I'm totally against baths! They are the worst! I've always wanted to be in commercials and be treated as the star I am!
  • Purity 1%
  • Age 19 months
  • Racing Exp 116
  • Labrador 18%
  • 27 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

27 races   |
  • 8 3 3
 Best Time15.28 sec
No rank  Racing *** Pts
51.9 % wins (14) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAACACCCTACGGACCAGTAAGACACTGAAGC
C
C
A
A
C
A
C
C
C
T
A
C
G
G
A
C
C
A
G
T
A
A
G
A
C
A
C
T
G
A
A
G
C
Genes: 54LJA5E8HBO

Composition

Labrador
18%
Husky
9%
Grey Wolf
9%
Border Collie
9%
Dachshund
9%
Shiba Inu
9%
Golder Retriever
9%
Rottweiler
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -6 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Grey Wolf
Front Legs Border Collie
Head Dachshund
Ears Labrador
Snout Shiba Inu
Mouth Golder Retriever
Nose Rottweiler
Eyes St. Bernard
Color Corgi