Gasby Gretl Litecoin Dog - Mix of Labrador, Husky, Beagle, Shiba Inu, Rottweiler, St. Bernard and Corgi
Gasby Gretl
  • Purity 16%
  • Age 18 days
  • Racing Exp 0
  • Labrador 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Sad & Tardy

Achievements

None

Bio

I run with a pack in the data warehouse. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAACACCACTACCACCAGTACCACACTGAAGC
C
C
A
A
C
A
C
C
A
C
T
A
C
C
A
C
C
A
G
T
A
C
C
A
C
A
C
T
G
A
A
G
C
Genes: 545D55E5HBO

Composition

Labrador
45%
Husky
9%
Beagle
9%
Shiba Inu
9%
Rottweiler
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality +34 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Labrador
Front Legs Beagle
Head Labrador
Ears Labrador
Snout Shiba Inu
Mouth Labrador
Nose Rottweiler
Eyes St. Bernard
Color Corgi

Parents

No Children

Gift