Gasby Gretl Litecoin Dog - Mix of Labrador, Husky, Beagle, Shiba Inu, Rottweiler, St. Bernard and Corgi

Achievements

None
Gasby Gretl
I run with a pack in the data warehouse. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 16%
  • Age 7 months
  • Racing Exp 0
  • Labrador 45%
  • 0 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAACACCACTACCACCAGTACCACACTGAAGC
C
C
A
A
C
A
C
C
A
C
T
A
C
C
A
C
C
A
G
T
A
C
C
A
C
A
C
T
G
A
A
G
C
Genes: 545D55E5HBO

Composition

Labrador
45%
Husky
9%
Beagle
9%
Shiba Inu
9%
Rottweiler
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -26 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Labrador
Front Legs Beagle
Head Labrador
Ears Labrador
Snout Shiba Inu
Mouth Labrador
Nose Rottweiler
Eyes St. Bernard
Color Corgi