Gasby Gretl Litecoin Dog - Mix of Labrador, Husky, Beagle, Shiba Inu, Rottweiler, St. Bernard and Corgi
Gasby Gretl
  • Purity 16%
  • Age 4 months
  • Racing Exp 17
  • Labrador 45%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 4 races
  • Gen 4
Sad & Snaillike

Achievements

Racer

Bio

I run with a pack in the data warehouse. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!

Racing Stats

Ran 4 races
  • 1 1 0
 Best Time16.03 sec
No rank  RacingĀ *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAACACCACTACCACCAGTACCACACTGAAGC
C
C
A
A
C
A
C
C
A
C
T
A
C
C
A
C
C
A
G
T
A
C
C
A
C
A
C
T
G
A
A
G
C
Genes: 545D55E5HBO

Composition

Labrador
45%
Husky
9%
Beagle
9%
Shiba Inu
9%
Rottweiler
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -26 points
Lunar Effect +8 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Labrador
Front Legs Beagle
Head Labrador
Ears Labrador
Snout Shiba Inu
Mouth Labrador
Nose Rottweiler
Eyes St. Bernard
Color Corgi