Dot Denali Bitcoin Dog - Mix of Labrador, Corgi, Beagle, Rottweiler, Dachshund and French Bulldog

Achievements

Podium Champion
Pro Racer
Master Champion
Dot Denali
Hi! My name is Dot Denali. I'm not a bad dog, my data is just configured that way. I enjoy chasing my tail around. Slipping my collar, running off and making my humans worried? Every chance I get. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery!
  • Purity 18%
  • Age 19 months
  • Racing Exp 155
  • Labrador 45%
  • 41 races
  • Gen 3
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

41 races   |
  • 7 5 7
 Best Time15.17 sec
No rank  Racing *** Pts
46.3 % wins (19) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAAGCCCACTACCACACGGACCAAGCCGACCA
C
C
A
A
G
C
C
C
A
C
T
A
C
C
A
C
A
C
G
G
A
C
C
A
A
G
C
C
G
A
C
C
A
Genes: 5O5D5HA5O95

Composition

Labrador
45%
Corgi
18%
Beagle
9%
Rottweiler
9%
Dachshund
9%
French Bulldog
9%

Current Energy

Vitality -26 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador
Tail Corgi
Legs Labrador
Front Legs Beagle
Head Labrador
Ears Rottweiler
Snout Dachshund
Mouth Labrador
Nose Corgi
Eyes French Bulldog
Color Labrador