Bessie Barley Crypto Game Dog - Mix of Labrador, Corgi, Rottweiler, Boxer, Border Collie, Maltese and French Bulldog

Achievements

Racer
Bessie Barley
This dawg chases mice in a big data warehouse. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. You know the worst? Watching my humans 'get it on' and I have to lick myself. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 9%
  • Age 23 months
  • Racing Exp 16
  • Labrador 27%
  • 3 races
  • Gen 2
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 1 0
 Best Time16.33 sec
No rank  Racing *** Coins
66.7 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACAGCCCATACACCCACCACCCAAGCCGACCA
A
A
C
A
G
C
C
C
A
T
A
C
A
C
C
C
A
C
C
A
C
C
C
A
A
G
C
C
G
A
C
C
A
Genes: GO5JKHH5O95

Composition

Labrador
27%
Corgi
18%
Rottweiler
18%
Boxer
9%
Border Collie
9%
Maltese
9%
French Bulldog
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail Corgi
Legs Labrador
Front Legs Border Collie
Head Maltese
Ears Rottweiler
Snout Rottweiler
Mouth Labrador
Nose Corgi
Eyes French Bulldog
Color Labrador