Verona Volvo Digital Cryptocurrency Dog - Mix of Labrador, Rottweiler, German Shepard, Corgi, Husky, Maltese, Yorkshire Terrier, French Bulldog and Shiba Inu

Achievements

Podium Champion
Pro Racer
Master Champion
Verona Volvo
I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I'm looking to share time together and not just to be an accessory.
  • Purity 5%
  • Age 41 months
  • Racing Exp 170
  • Labrador 18%
  • 39 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 10 6 5
39 races    Best Time14.18 sec
Rank 50  Racing *** Coins
53.8 % wins (21) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGCACACCAACCCACCACCCATTACGAGTA
T
C
A
A
G
C
A
C
A
C
C
A
A
C
C
C
A
C
C
A
C
C
C
A
T
T
A
C
G
A
G
T
A
Genes: 7O45KHH5F9E

Composition

Labrador
18%
Rottweiler
18%
German Shepard
9%
Corgi
9%
Husky
9%
Maltese
9%
Yorkshire Terrier
9%
French Bulldog
9%
Shiba Inu
9%

Current Energy

Vitality -11 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Husky
Front Legs Labrador
Head Maltese
Ears Rottweiler
Snout Rottweiler
Mouth Labrador
Nose Yorkshire Terrier
Eyes French Bulldog
Color Shiba Inu