Woz Woody Crypto Dog - Mix of Corgi, Labrador, Rottweiler, German Shepard, Husky, Maltese, Pitbull terrier and St. Bernard

Achievements

Racer
Podium Champion
Master Champion
Woz Woody
Yo dog! Woz Woody here. I adore sleeping upside down with my tongue hanging out! I like big butts, I cannot lie. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? My favorite sport is catching treats my human throws!
  • Purity 6%
  • Age 38 months
  • Racing Exp 97
  • Corgi 18%
  • 28 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

28 races   |
  • 5 4 2
 Best Time14.42 sec
No rank  Racing *** Pts
39.3 % wins (11) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAAGCACACCAACCCACCACCCATCCAGCTGA
T
C
A
A
G
C
A
C
A
C
C
A
A
C
C
C
A
C
C
A
C
C
C
A
T
C
C
A
G
C
T
G
A
Genes: 7O45KHH5NOB

Composition

Corgi
18%
Labrador
18%
Rottweiler
18%
German Shepard
9%
Husky
9%
Maltese
9%
Pitbull terrier
9%
St. Bernard
9%

Current Energy

Vitality -11 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Husky
Front Legs Labrador
Head Maltese
Ears Rottweiler
Snout Rottweiler
Mouth Labrador
Nose Pitbull terrier
Eyes Corgi
Color St. Bernard