Geppetto Grand Slam Cryptocurrency Dog - Mix of Grey Wolf, German Shepard, Husky, Shiba Inu, Yorkshire Terrier, Poodle, Border Collie, Pitbull terrier, Corgi and St. Bernard

Achievements

Pro Racer
Podium Champion
Master Champion
Geppetto Grand Slam
Size matters. This dawg's into big databases. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I need someone that "brings home the bacon"!
  • Purity 1%
  • Age 42 months
  • Racing Exp 157
  • Grey Wolf 18%
  • 45 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

45 races   |
  • 8 6 4
 Best Time14.38 sec
Rank 57  Racing *** Coins
40.0 % wins (18) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTCACCCACAGTATTAGACTACTCCAGCTGA
C
C
C
T
C
A
C
C
C
A
C
A
G
T
A
T
T
A
G
A
C
T
A
C
T
C
C
A
G
C
T
G
A
Genes: L7L4EFIJNOB

Composition

Grey Wolf
18%
German Shepard
9%
Husky
9%
Shiba Inu
9%
Yorkshire Terrier
9%
Poodle
9%
Border Collie
9%
Pitbull terrier
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality -3 points
Lunar Effect -6 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Grey Wolf
Front Legs Husky
Head Shiba Inu
Ears Yorkshire Terrier
Snout Poodle
Mouth Border Collie
Nose Pitbull terrier
Eyes Corgi
Color St. Bernard