Beanie Black-Jack Cryptocurrency Dog - Mix of Grey Wolf, Border Collie, Corgi, Shiba Inu, Yorkshire Terrier, Poodle, Golder Retriever and Schnauzer

Achievements

Racer
Beanie Black-Jack
Hey! My name's Beanie Black-Jack! Ima Ethernet dog. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I don't understand why I like smelling butts... You may prefer walking, but hey, if a human wants to carry me, I'll let 'em.
  • Purity 11%
  • Age 42 months
  • Racing Exp 8
  • Grey Wolf 36%
  • 2 races
  • Gen 3
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 1 0
 Best Time15.50 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACAGCCCCCCCGTATTAGACAGACCCATACCC
T
A
C
A
G
C
C
C
C
C
C
C
G
T
A
T
T
A
G
A
C
A
G
A
C
C
C
A
T
A
C
C
C
Genes: JOLLEFI8LCL

Composition

Grey Wolf
36%
Border Collie
9%
Corgi
9%
Shiba Inu
9%
Yorkshire Terrier
9%
Poodle
9%
Golder Retriever
9%
Schnauzer
9%

Current Energy

Vitality -7 points
Lunar Effect -10 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Yorkshire Terrier
Snout Poodle
Mouth Golder Retriever
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf