Hercules Holden Bitcoin Dog - Mix of Grey Wolf, Border Collie, Golder Retriever, Corgi, St. Bernard and Schnauzer

Achievements

Racer
Hercules Holden
I was born in the web cloud. I'd like to leave my paw prints in the sand next to yours on a moonlit beach. I love a good book... I find them quite tasty. I'm a serial monogamist. Blue toilet water turns me off.
  • Purity 12%
  • Age 41 months
  • Racing Exp 16
  • Grey Wolf 36%
  • 4 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 1
4 races    Best Time15.12 sec
No rank  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACAGCCCCTGATACAGACCCAGACCCATACCC
T
A
C
A
G
C
C
C
C
T
G
A
T
A
C
A
G
A
C
C
C
A
G
A
C
C
C
A
T
A
C
C
C
Genes: JOLBJ8L8LCL

Composition

Grey Wolf
36%
Border Collie
18%
Golder Retriever
18%
Corgi
9%
St. Bernard
9%
Schnauzer
9%

Current Energy

Vitality -14 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Grey Wolf
Front Legs St. Bernard
Head Border Collie
Ears Golder Retriever
Snout Grey Wolf
Mouth Golder Retriever
Nose Grey Wolf
Eyes Schnauzer
Color Grey Wolf