Kong King Hippo Litecoin Dog - Mix of Border Collie, Pug, Schnauzer, Golder Retriever, Grey Wolf, German Shepard and Rottweiler

Achievements

Racer
Kong King Hippo
Hello, I be Kong King Hippo. If you have fleas or ticks, don't bother. I like it when you're frisky. As a designer, I suggest low windows or couch backs next to windows without curtains. Trust me. Leashes, collar and whips can be fun if you know what you're doing.
  • Purity 8%
  • Age 41 months
  • Racing Exp 2
  • Border Collie 18%
  • 2 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
2 races    Best Time16.22 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAACCCATATACAGAAGAGAATCAATACAC
T
A
C
G
A
A
C
C
C
A
T
A
T
A
C
A
G
A
A
G
A
G
A
A
T
C
A
A
T
A
C
A
C
Genes: J2LCJ8827CH

Composition

Border Collie
18%
Pug
18%
Schnauzer
18%
Golder Retriever
18%
Grey Wolf
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality -19 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Grey Wolf
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Pug
Nose German Shepard
Eyes Schnauzer
Color Rottweiler