Kobe Katniss

Hola! My name is Kobe Katniss. I was born in the web cloud. Too much steak gives me the runs! I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! When I can break free, I enjoy exploring my neighborhood without my human.

Purity 9%
Age 51 months
Racing Exp 62

Border Collie 18%
16 races
Gen 2

Depressed & Snaillike

Energy: ▂▃▅▆▇

Racing Stats


16 races \| 2 2 4	Best Time	14.48 sec
No rank	Racing	*** Coins
50.0 % wins (8)	Breeding	*** Coins
Scheduled races 0	Total	*** Coins

DNA Analysis

DNA Sequence: TACGAAGACATATACAGAAGAGAACACATACAC

Genes: J2ICJ882HCH

Composition

Border Collie	18%
Pug	18%
Schnauzer	18%
Golder Retriever	18%
Rottweiler	18%
Poodle	9%

Current Energy

Vitality	-34 points
Lunar Effect	+2 points

Traits Breakdown

Body	Border Collie
Tail	Pug
Legs	Poodle
Front Legs	Schnauzer
Head	Border Collie
Ears	Golder Retriever
Snout	Golder Retriever
Mouth	Pug
Nose	Rottweiler
Eyes	Schnauzer
Color	Rottweiler