Big Guy Blanche Digital Cryptocurrency Game Dog - Mix of Golder Retriever, Border Collie, Pug, Labrador BK, Schnauzer and Dachshund

Achievements

Racer
Big Guy Blanche
I answer to 'Big Guy Blanche'. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I hate bubble baths; mud puddles are more my style. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 15%
  • Age 38 months
  • Racing Exp 9
  • Golder Retriever 36%
  • 4 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 0 0 1
 Best Time14.58 sec
No rank  Racing *** Pts
25.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACGAAAGAGCATACAGAAGATACAGAATAGGA
T
A
C
G
A
A
A
G
A
G
C
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
T
A
G
G
A
Genes: J286J88J8CA

Composition

Golder Retriever
36%
Border Collie
27%
Pug
9%
Labrador BK
9%
Schnauzer
9%
Dachshund
9%

Current Energy

Vitality -9 points
Lunar Effect -10 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Golder Retriever
Front Legs Labrador BK
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes Schnauzer
Color Dachshund