Dylan Dickens Bitcoin Dog - Mix of Golder Retriever, Border Collie, Schnauzer, Pug and Dachshund

Achievements

None
Dylan Dickens
I'm going kill that damn Nyan Cat if I can catch it. Power outages and computer viruses scare me! The place I like most in the world is curled up in my human's bed, hogging all the covers! I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.
  • Purity 16%
  • Age 42 months
  • Racing Exp 0
  • Golder Retriever 36%
  • 0 races
  • Gen 6
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAAAGAATATACAGAAGATACAGAATAGGA
T
A
C
G
A
A
A
G
A
A
T
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
T
A
G
G
A
Genes: J28CJ88J8CA

Composition

Golder Retriever
36%
Border Collie
27%
Schnauzer
18%
Pug
9%
Dachshund
9%

Current Energy

Vitality -26 points
Lunar Effect -2 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Golder Retriever
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes Schnauzer
Color Dachshund