Dylan Dickens Bitcoin Dog - Mix of Golder Retriever, Border Collie, Schnauzer, Pug and Dachshund

Achievements

Racer
Dylan Dickens
I'm going kill that damn Nyan Cat if I can catch it. Power outages and computer viruses scare me! The place I like most in the world is curled up in my human's bed, hogging all the covers! I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.
  • Purity 16%
  • Age 38 months
  • Racing Exp 2
  • Golder Retriever 36%
  • 2 races
  • Gen 6
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time17.20 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACGAAAGAATATACAGAAGATACAGAATAGGA
T
A
C
G
A
A
A
G
A
A
T
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
T
A
G
G
A
Genes: J28CJ88J8CA

Composition

Golder Retriever
36%
Border Collie
27%
Schnauzer
18%
Pug
9%
Dachshund
9%

Current Energy

Vitality -26 points
Lunar Effect -20 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Golder Retriever
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes Schnauzer
Color Dachshund