Hannibal Home Plate Cryptocurrency Dog - Mix of Golder Retriever, Poodle, Shiba Inu, Maltese, Border Collie, Labrador and Labrador BK

Achievements

Racer
Hannibal Home Plate
Hullo. My name is Hannibal Home Plate. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. I am a proud show dog. I like showing off my perfect coat! I'm looking for someone to make bath time a little more bearable!
  • Purity 14%
  • Age 41 months
  • Racing Exp 1
  • Golder Retriever 36%
  • 1 races
  • Gen 7
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.17 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACGTAAGAACCTACAGAAGACCAAGAGCAGAC
G
A
C
G
T
A
A
G
A
A
C
C
T
A
C
A
G
A
A
G
A
C
C
A
A
G
A
G
C
A
G
A
C
Genes: IE8KJ88586I

Composition

Golder Retriever
36%
Poodle
18%
Shiba Inu
9%
Maltese
9%
Border Collie
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -37 points
Lunar Effect -10 points

Traits Breakdown

Body Poodle
Tail Shiba Inu
Legs Golder Retriever
Front Legs Maltese
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Labrador
Nose Golder Retriever
Eyes Labrador BK
Color Poodle