Fox Mccloud Frank West Cryptocurrency Dog - Mix of Golder Retriever, Border Collie, Poodle, Schnauzer, Labrador and French Bulldog

Achievements

Pro Racer
Master Champion
Podium Champion
Fox Mccloud Frank West
Good day to you! I'm Fox Mccloud Frank West! I'm not a bad dog, my data is just configured that way. I like to respond to sad puppy eyes with sad puppy eyes of my own. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos.
  • Purity 15%
  • Age 38 months
  • Racing Exp 125
  • Golder Retriever 36%
  • 34 races
  • Gen 8
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

34 races   |
  • 6 4 5
 Best Time14.48 sec
No rank  Racing *** Pts
44.1 % wins (15) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACTACAGAATATACAGAAGACCAAGATACCGA
G
A
C
T
A
C
A
G
A
A
T
A
T
A
C
A
G
A
A
G
A
C
C
A
A
G
A
T
A
C
C
G
A
Genes: IJ8CJ8858J9

Composition

Golder Retriever
36%
Border Collie
27%
Poodle
9%
Schnauzer
9%
Labrador
9%
French Bulldog
9%

Current Energy

Vitality -22 points
Lunar Effect -14 points

Traits Breakdown

Body Poodle
Tail Border Collie
Legs Golder Retriever
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Labrador
Nose Golder Retriever
Eyes Border Collie
Color French Bulldog