Fox Mccloud Frank West Cryptocurrency Dog - Mix of Golder Retriever, Border Collie, Poodle, Schnauzer, Labrador and French Bulldog
Fox Mccloud Frank West
  • Purity 15%
  • Age 74 months
  • Racing Exp 77
  • Golder Retriever 36%
  • Gold medal 4 Silver medal 1 Bronze medal 5
  • 18 races
  • Gen 8
Depressed & Snaillike

Achievements

Pro Racer
Master Champion
Podium Champion

Bio

Good day to you! I'm Fox Mccloud Frank West! I'm not a bad dog, my data is just configured that way. I like to respond to sad puppy eyes with sad puppy eyes of my own. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos.

Racing Stats

Ran 18 races
  • 4 1 5
 Best Time14.48 sec
Rank 61  RacingĀ *** Pts
55.6% wins (10) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GACTACAGAATATACAGAAGACCAAGATACCGA
G
A
C
T
A
C
A
G
A
A
T
A
T
A
C
A
G
A
A
G
A
C
C
A
A
G
A
T
A
C
C
G
A
Genes: IJ8CJ8858J9

Composition

Golder Retriever
36%
Border Collie
27%
Poodle
9%
Schnauzer
9%
Labrador
9%
French Bulldog
9%

Current Energy

Vitality -22 points
Lunar Effect -14 points

Traits Breakdown

Body Poodle
Tail Border Collie
Legs Golder Retriever
Front Legs Schnauzer
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Labrador
Nose Golder Retriever
Eyes Border Collie
Color French Bulldog