Pinto Porter Digital Cryptocurrency Dog - Mix of Golder Retriever, Husky, Schnauzer, Pug and French Bulldog
Pinto Porter
  • Purity 32%
  • Age 15 days
  • Racing Exp 47
  • Golder Retriever 55%
  • Gold medal 3 Silver medal 2 Bronze medal 1
  • 9 races
  • Gen 9
Sad & Tardy

Achievements

Racer
Podium Champion

Bio

Hi, I'm Pinto Porter. I hate it when humans put the lid down. I'm willing to try little bondage, so my human chained me up! My favorite treat is to steal the pepperoni off of pizza. If you are tall enough to reach the door handle, I 'specially wanna meet you.

Racing Stats

Ran 9 races
  • 3 2 1
 Best Time15.70 sec
Rank 11  RacingĀ *** Pts
66.7 % wins (6) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACAACAAGAATAGAAAGAAGAAGAAGAAGACGA
A
C
A
A
C
A
A
G
A
A
T
A
G
A
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
C
G
A
Genes: 448C2888889

Composition

Golder Retriever
55%
Husky
18%
Schnauzer
9%
Pug
9%
French Bulldog
9%

Current Energy

Vitality +23 points
Lunar Effect +14 points

Traits Breakdown

Body Husky
Tail Husky
Legs Golder Retriever
Front Legs Schnauzer
Head Pug
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Golder Retriever
Color French Bulldog