Lucky Little-One Digital Cryptocurrency Dog - Mix of German Shepard, Labrador BK, Pug and Dachshund

Achievements

None
Lucky Little-One
Hi, I'm Lucky Little-One. I hate it when humans put the lid down. I'm willing to try little bondage, so my human chained me up! My favorite treat is to steal the pepperoni off of pizza. If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 52%
  • Age 3 months
  • Racing Exp 0
  • German Shepard 73%
  • 0 races
  • Gen 20
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGAATCATCATCATCATCAGGATCATCATCA
G
C
A
G
A
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
G
A
T
C
A
T
C
A
T
C
A
Genes: 6277777A777

Composition

German Shepard
73%
Labrador BK
9%
Pug
9%
Dachshund
9%

Current Energy

Vitality -5 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth Dachshund
Nose German Shepard
Eyes German Shepard
Color German Shepard